EST details — SGN-C72187

Search information 
Request: 72187Match: SGN-C72187
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72187Clone name: cLER-1-G5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185029 is on microarray TOM1: SGN-S1-1-6.2.12.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72187 [cLER-1-G5] Trace: SGN-T91844 EST: SGN-E280290 Direction: 3' Facility: TIGR
Clone: SGN-C185029 [TUS-46-F3] Trace: SGN-T199025 EST: SGN-E397699 Direction: 5' Facility: INRA
Clone: SGN-C185029 [TUS-46-F3] Trace: SGN-T199088 EST: SGN-E397762 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280289Length: 352 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280289 [] (trimmed) TGGAGAAATGGGACAAGACTTACTGGCCAACATACAAGGTGCTTGATATCTTGCAGAAGGTATTTTACAGGTCGAATCCAGCAAGAGAAGCTTTC
GTGGAGATGTGCGCTGATGAGTATGTGCAGAAGATGACATTCGACAGCTATTTGTACAAGAAAGTTGCACCAGGAAACCCCATTGAAGACTTGAA
GCTTGCTGTGAATACCATTGGAAGTTTGGTGAGGGCTAATGCACTAAGAAGGGAAATGGACAAACTCAGTGTATAAGAAGAGGATAAAATTTCAT
AGTAGCTAATATTTTGTAAACTTGATTTGTAATTGAAGTATTTATGCCTTTTATCGAATTTCATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280289] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91843 [Download][View] Facility Assigned ID: TPRAA39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0099 Quality Trim Threshold: 12.5