EST details — SGN-C72193

Search information 
Request: 72193Match: SGN-C72193
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72193Clone name: cLER-1-H10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183613 is on microarray TOM1: SGN-S1-1-6.3.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183613 [TUS-42-K3] Trace: SGN-T194947 EST: SGN-E393621 Direction: 5' Facility: INRA
Clone: SGN-C183613 [TUS-42-K3] Trace: SGN-T194947 EST: SGN-E399172 Direction: 5' Facility: INRA
Clone: SGN-C183613 [TUS-42-K3] Trace: SGN-T200249 EST: SGN-E399171 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280638Length: 460 bp (810 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280638 [] (trimmed) CGAAACTGGAGTTGAACTCATATTCTTGGACCAAGGTGGCAAACATAATATTTATAGATCAACCTGCTGGCACAGGCTACTCATATGCAAACACT
TCAGAAGCTTACAACTGCAATGACACCCTCTCTGTAACTCTAACTTATGACTTCCTTAGAAAGTGGCTTATGGATCATCCCGAGTATCTCAACAA
TCCACTATATGTTGGTGGTGATTCCTACTCAGGCATTTTTGTTGCACTGCTTACTCGCAAAATATACGATGGTATTGAAGTTGGTGACAGGCCTC
GAGTTAATATCAAAGGATATATACAAGGCAATGCTCTAACAGATAGATCCATCGACTTCAATGGTAGAGTCAAATATGCTAATCATATGGGACTT
ATTTCAGATAAGATCTATCAGTCGGCGAAAGCAAATTGCAATGGGAATTACATTGACGTTGATCCAAATAACATATTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280638] SGN-U580963 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92192 [Download][View] Facility Assigned ID: TPRAD41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5