EST details — SGN-C72216

Search information 
Request: 72216Match: SGN-C72216
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72216Clone name: cLER-1-I13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178568 is on microarray TOM1: SGN-S1-1-3.4.3.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72216 [cLER-1-I13] Trace: SGN-T92056 EST: SGN-E280502 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280501Length: 377 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280501 [] (trimmed) TTTTTTTCAAGTCGCCAAAACGCCCAAAAATAAAAGTTACGTCAGTCATGATAAAGCATACTATCTATTTCAACAACACACTTGATGCATCTCAA
GGAGAAGATGCAACATATAATACATAAATAGTAATGTACCCAAAAAGGCGAATGAATGCAGTTGATATTCATTCCCACTGTCCCCCATCCACAAG
GATCACAAAAAGAAAGACAACTCAGGTGAAGGGATAAAAGAAAACATCCTTTCACCAAAACATTCAAACAGAGATGGCAACAACCGTACGGCATC
CAGATCTTCCTTCCAGGCCTGATCAAGAGGAACCGATGTTTTTTGACCTTGACCAGTAGTCATATGCCTTCTACCAATGGTCCTCAGCATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280501] SGN-U567340 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92055 [Download][View] Facility Assigned ID: TPRAA55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5