EST details — SGN-C72268

Search information 
Request: 72268Match: SGN-C72268
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72268Clone name: cLER-1-K3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178609 is on microarray TOM1: SGN-S1-1-2.2.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72268 [cLER-1-K3] Trace: SGN-T91862 EST: SGN-E280308 Direction: 3' Facility: TIGR
Clone: SGN-C178609 [TUS-29-J15] Trace: SGN-T1502 EST: SGN-E378282 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178609 [TUS-29-J15] Trace: SGN-T184139 EST: SGN-E371070 Direction: 3' Facility: INRA
Clone: SGN-C178609 [TUS-29-J15] Trace: SGN-T184140 EST: SGN-E371071 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280307Length: 352 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280307 [] (trimmed) ATGCGCTAAACAACAACATATGCCCAACTAAAAAACTGGGTCAAAAACAAAGAAACAACGATGATACAAAGAGAAAAACAATTAGTACAACAAAC
CCCAGAGCAAGGGATCAGATCGGCGCCAACCTGTGGGTCAAATCCTCCTAGCACATTACATCAAATAGCAAATGTCTATGATAATCTATAACTAG
GCTTCCAATAAAGTCACAAGTCACCAGAAAGGATTATTCAGGTCACATTCAACAAAAACATAAATTCAAAAACTGACATAAAAGGTTCCACTAGC
AATTCAATCTTCACTGAGAGGTAAAACCATATAATATAACATTCTTTCTCAGGCAGAAGCTTCAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280307] SGN-U581855 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91861 [Download][View] Facility Assigned ID: TPRAA62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0279 Quality Trim Threshold: 14.5