EST details — SGN-C7230

Search information 
Request: 7230Match: SGN-C7230
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C7230Clone name: cLEC-38-E2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174195 is on microarray TOM1: SGN-S1-1-8.2.16.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208968Length: 456 bp (767 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208968 [] (trimmed) CAGGTTCATTTAAGGTTACCCAAAGATGATCGTGACAGGATACCATTAAAGCTCATCCCAGATGATGATGATGATGATGATGACTACACATATGG
GACAACCAATTTTCGAGTTTTCCAAGTCGATTCAGCTGCTGGCATAATGACGGAAACCAGGGAATTAGGGGACACAACTTTTTTTCTAGCCTATG
AAGAAGGAGGAGGGTTGGACATGGGGGTGTTCAACCTAGCAGATGGAAGCATTCAGCCGCATTACAATGGTGTTTCCCTCAGTCGTTTTTGTCCT
CCAACTTGGTTCTTTTGTTTCTCGCGGCGCTCTGGATGAACATCATCAAATTGGGCCTATACATTACAAGCTGGGATCAGTTGCTACCTTGTTTC
TGTTTGAATTGAAATGAAGAAAGTCAGTGAAGAGGAGAAAGAAGCCAATGAAGCTCAAGTTTTGACTACTGGGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208968] SGN-U577590 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31503 [Download][View] Facility Assigned ID: TCAFT25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0161 Quality Trim Threshold: 14.5