EST details — SGN-C72335

Search information 
Request: 72335Match: SGN-C72335
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72335Clone name: cLER-1-N8
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178658 is on microarray TOM1: SGN-S1-1-1.4.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178658 [TUS-29-L16] Trace: SGN-T1505 EST: SGN-E378178 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178658 [TUS-29-L16] Trace: SGN-T184291 EST: SGN-E371524 Direction: 3' Facility: INRA
Clone: SGN-C178658 [TUS-29-L16] Trace: SGN-T184292 EST: SGN-E371525 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280452Length: 239 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280452 [] (trimmed) AACGGGAGAGAATAGAGCAAATTCTCTCTCTGTTTTCACTACAAAAAATCTTTGATTTCAATTTGAGAGAGATCGGAAATGGCTTCTTCCAAAGA
ACGCGAGAACTTCGCCTACGTCGCTAACCTCGATGCTACTGCCGAACGCTACGATGAAATGGTTGAAGCGATGAAAAATGTCGCAAACATGGATG
TTGAATTGACTGAGGAGGAAAGGAATCTTCTTTCTGATGGATATAACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280452] SGN-U578295 Tomato 200607 Build 2 99 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92006 [Download][View] Facility Assigned ID: TPRAD76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0335 Quality Trim Threshold: 14.5