EST details — SGN-C74660

Search information 
Request: 74660Match: SGN-C74660
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C74660Clone name: cLES-11-B13
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185512 is on microarray TOM1: SGN-S1-1-3.2.10.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185512 [TUS-47-J6] Trace: SGN-T192674 EST: SGN-E391348 Direction: 3' Facility: INRA
Clone: SGN-C185512 [TUS-47-J6] Trace: SGN-T197691 EST: SGN-E396365 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286227Length: 525 bp (761 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286227 [] (trimmed) CTATACATTTTTCATTTCTGTATCAATCAATATTCTTTGTTTCTGCTGTTTTGAGTAAATCACACTAAGATGTGTGGTGGTGCAATTCTTGCTGA
TATCATTCCTCCTCGTGACCGCCGTTTGTCATCCACCGACCTATGGCCGACTGATTTCTGGCCAATTTCCACCCAAAATGTTCCTCTCAACCCCA
AACGAGCTCGACCCTCTACAGGTGGTGAGCAGATGAAGAAGAGGCAAAGGAAGAATCTTTACAGAGGGATAAGACAACGTCCATGGGGTAAATGG
GCTGCTGAAATTCGTGACCCGAGAAAAGGGGTTAGGGTTTGGTTAGGTACTTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATAGAGAAGC
TCGTAAAATCAGGGGTAAGAAAGCTAAAGTTAATTTCCCCAATGAAGATGACGACCATTACTGCTACAGTCATCCAGAGCCCACTCCCTTGAACA
TTGCTTGTGATACTACTGTTACTTACAATCAAGAATCAAATAACTGTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286227] SGN-U584756 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99758 [Download][View] Facility Assigned ID: TPSBQ07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5