EST details — SGN-C74979

Search information 
Request: 74979Match: SGN-C74979
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C74979Clone name: cLES-12-F17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183522 is on microarray TOM1: SGN-S1-1-1.3.2.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T195032 EST: SGN-E393706 Direction: 3' Facility: INRA
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T196023 EST: SGN-E394697 Direction: 5' Facility: INRA
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T196023 EST: SGN-E399259 Direction: 5' Facility: INRA
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T200295 EST: SGN-E399258 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286640Length: 385 bp (796 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286640 [] (trimmed) GGCAGCTTCGGTCCATTGTGCAACAAGAGCAGCCATAAGAGCAGCACGTGAACAGCTCAAACGTTGGGACAAGCTCGACGAGTCTGCTTCAGAAT
TTTATCTAGATGTCCCTGCAATATTACCAGTTGTGAAGACACAGTGTGGCCTGGATTATGCAGAGAAGTTCGTAGAAACTCTGCTGGCTCGAAAA
TCAACGTGTTTCAAATGATACTAAGCTATGTTGCTCGGACTCTCCAAAGAATGTTATCGTACCTGTGTTGATTCCTCTAAAAATACACTACTTTT
TGAGGATCTGACATGCACCGAGTCATGATCATGTCTACTACATCTTTAATATTCACCAAATTAGTACATGACTAAAGAGCTATATATGGTAATTA
CTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286640] SGN-U582239 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100171 [Download][View] Facility Assigned ID: TPSBU33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5