Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C75131

Search information 
Request: 75131Match: SGN-C75131
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75131Clone name: cLES-12-P3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185522 is on microarray TOM1: SGN-S1-1-1.2.9.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185522 [TUS-47-J16] Trace: SGN-T192491 EST: SGN-E391165 Direction: 5' Facility: INRA
Clone: SGN-C185522 [TUS-47-J16] Trace: SGN-T192677 EST: SGN-E391351 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286548Length: 536 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286548 [] (trimmed) AAAATGGCAAATTTGTTCATTAAGCAAGCACAACAATATTCAAAGGGTAGGCCAAGTTACCCTCAAGAATTATTCAATTTCATTGCTTCTAAAAC
ACCTTCTCATGATCTTGTTTGGGATGTTGGTACTGGTAGTGGCCAGGCTGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGCTACAGACA
CAAGTCCAAAGCAGCTTGAATTTGCAGCAAAGGTTCCAAATGTTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAA
ATAGGATCAGAATCAAGTGTAGATTTAGTAACAATTGCACAAGCAATGCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACT
CAAGAAACCAAATGGTGTTATAGCATCATGGTGTTACACTACACCTAANATAAACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTG
ATGCTGGACCTTATTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286548] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100079 [Download][View] Facility Assigned ID: TPSBU86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5