EST details — SGN-C75270

Search information 
Request: 75270Match: SGN-C75270
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75270Clone name: cLES-13-H14
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184362 is on microarray TOM1: SGN-S1-1-1.2.16.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184362 [TUS-44-J8] Trace: SGN-T198408 EST: SGN-E397082 Direction: 3' Facility: INRA
Clone: SGN-C184362 [TUS-44-J8] Trace: SGN-T198409 EST: SGN-E397083 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286154Length: 510 bp (796 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286154 [] (trimmed) CAAAAAGTTCTTTTAAACAAAATTTGCAGTTACAAAATTACATCCAAAAAGAGCATAATACAGAAGCCTCTTGGAGGAGGTGGAGGTGGAGGTGG
AGAGGGCAGAGGAAGATGCAGTTCTGCAATTGCTATCGACGCGCCAGCTGCTTTTACCAGTGTTTCTGGCATCAGATGGGGTTCAACTATGGTCC
ATGGTCCGCGTGAAGAGATGGAAGATGATGCTGTTATCGTTCAATCGGATGATCTTGATGGCTTCACTTATGCTGCTGTTTTTGATGGCCATGCT
GGCTACTTCTCTGTCAAGTTCCTTAGGGAAGAGCTGTATAAAGAATGTGTTCTAGCATTACAAGGAGGGCCGCTATTGAACAGATAGGACCTAAA
TGCAATCAGGAAGGCACTACAAGACGCTGTTGAAAATGCGGATAGGGAACTCTTGAACCGGCTTGAGAGTAGCGAGAAGGAAGATGAATCTGGTG
CGACAGCTACTGGTCTATTTGTTGGGAATGATACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286154] SGN-U570064 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100467 [Download][View] Facility Assigned ID: TPSBZ43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5