EST details — SGN-C76454

Search information 
Request: 76454Match: SGN-C76454
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C76454Clone name: cLES-18-B2
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179130 is on microarray TOM1: SGN-S1-1-1.4.3.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179130 [TUS-30-P8] Trace: SGN-T184897 EST: SGN-E372105 Direction: 3' Facility: INRA
Clone: SGN-C179130 [TUS-30-P8] Trace: SGN-T184898 EST: SGN-E372106 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289317Length: 295 bp (988 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289317 [] (trimmed) CAAAAATCATATTAATCAATTGACTTAGATATTTTGATTGATAGAAGATGCCGATGCGACCAACAGGGGGATTGAAACAAGATTGGGATCCAATC
GTGCTGCAGAAGCCAAAGATGAAGGCCCAAGACCTGAAGGATCCAAAAATTGTGAATCAGGCATTGCGAGCTGGAGCACAAGTTCAAACGGTGAA
GAAAATCGACGCTGGTTTGAATAATAAGGCGGTGACGTTGGCAGTTAATGTAAGAAAGCTAGATGAGGCGGCGGAACCAGCGGCACTTGAGAAAT
TGCCGGTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289317] SGN-U566716 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101759 [Download][View] Facility Assigned ID: TPSCT01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0220 Quality Trim Threshold: 12.5