EST details — SGN-C77107
| Search information |
| Request: 77107 | Match: SGN-C77107 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C77107 | Clone name: cLES-1-O21 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C186009 is on microarray TOM1: SGN-S1-1-2.2.7.15
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E283786 | Length: 176 bp (826 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E283786 [] (trimmed)
GGTTGACGTGTTGTTGCTCGGTGGAGGAATGATCTTTACTTTCTACAAGGCCCAAGGTTATGCTGTTGGATCATCACTAGTGGAGGAGGACAAAC
TTGACTTGGCAACATCTCTCATGGAGAAGGCAAAGACAAAAGGGGTATCTCTATTGCTTCCCACGGATGTACTGATTTGCG
TTGACTTGGCAACATCTCTCATGGAGAAGGCAAAGACAAAAGGGGTATCTCTATTGCTTCCCACGGATGTACTGATTTGCG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E283786] | SGN-U578082 | Tomato 200607 | Build 2 | 159 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T97462 [Download][View] | Facility Assigned ID: TPSAA95TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.948 | Expected Error Rate: 0.0099 | Quality Trim Threshold: 14.5 |
Working
