Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C77110

Search information 
Request: 77110Match: SGN-C77110
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77110Clone name: cLES-1-O5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184226 is on microarray TOM1: SGN-S1-1-1.4.16.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77110 [cLES-1-O5] Trace: SGN-T97457 EST: SGN-E283781 Direction: 3' Facility: TIGR
Clone: SGN-C184226 [TUS-44-D16] Trace: SGN-T198370 EST: SGN-E397044 Direction: 5' Facility: INRA
Clone: SGN-C184226 [TUS-44-D16] Trace: SGN-T199991 EST: SGN-E398665 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283780Length: 366 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283780 [] (trimmed) GTCGGACCCTAGTTTCTTCACCCCACAATCTCCGTCGAACTGGCGATGATCGATAACATCGATGATATCATCAACTGGGACGATGTAGATCACAT
CTTTCACAACGTTCTAGACAATCCCGACGATGATCAATTCACTCTTCATGATTCCTTCCCACAGTCATTCCAGCAGATCGAGCAGCTTCTTATGA
ACGATGACGATTTCGGTCTTGTCTCTGATCCTCAGTTTGCTGCCGAATCTCTTTCTGACTTCCTCGCCGATTCTCCTCTTCACTCCGATCATTCT
GACTCTGCTGCTGAACAAGCCATTGGATTCTCCGATCCCAAGGGTTCAAGTGCCGATCAGGACAAACACAAGGTTTGCCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283780] SGN-U580933 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97456 [Download][View] Facility Assigned ID: TPSAA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0313 Quality Trim Threshold: 14.5