EST details — SGN-C77182

Search information 
Request: 77182Match: SGN-C77182
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77182Clone name: cLES-20-D17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186367 is on microarray TOM1: SGN-S1-1-4.1.5.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290405Length: 363 bp (1115 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290405 [] (trimmed) GTTCCGTAGGTCTTGCTTCTCTTGGGGATGCTGCCCACTTGAAGGAGCCACTTGCTGTGAAGACCACTACAGTTGCTGCCCACACGACTATCCTA
TCTGCAATGTTCGTCAAGGAACATGCTCAATGAGCAAGGGCAACCCACTGGGAGTGAAGGCAATGAAGCGCATTCTTGCACAACCTATTGGGGCC
TTCGGAAATGGAGGAAAGAAGAGCAGTTCTTGAATTCTACAAGCACCAATACTGCGGAATGGGGTGAAAAAGCAGGGACAACAGAGGACGTGAAT
CGATACATTGATTAACAAAACCTCATTTTTCCAGCAGAAAGGTGTAGAAACAGATGAATGCATTATCAAGATTACAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290405] SGN-U578421 Tomato 200607 Build 2 107 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102084 [Download][View] Facility Assigned ID: TPSDA21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5