EST details — SGN-C77259

Search information 
Request: 77259Match: SGN-C77259
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77259Clone name: cLES-20-G24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179290 is on microarray TOM1: SGN-S1-1-1.2.2.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179290 [TUS-31-F24] Trace: SGN-T185646 EST: SGN-E373508 Direction: 3' Facility: INRA
Clone: SGN-C179290 [TUS-31-F24] Trace: SGN-T185647 EST: SGN-E373509 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290537Length: 373 bp (755 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290537 [] (trimmed) TTTTTTTCAAGCTGGAAATGCTCAACTTTATTACTATATGAAACTGCAATCGTGTAAAAATAACGCAGGTCAAGATCAGCAGCAAGAGCCAAAAC
AAAACATTAAGAAAGATACATTTCCTAAAATAAAGATGGACCATTTCAATATTATAAGCAATCAGAAGAAGCTCAAGCTTTTGTCATCAGAACTA
TTGTTGCCTGCAGTTATCTCTTTCCCTCTCTCCAAGCATCCAAAAAAACATAATCAAAATTGCAATTTTATTTTTTGTCTTATGGAAGTGTGGCT
CTGAGTTCTTTCCTATCTGCTCCAAAGACCTCAACTCCAAACCCTTTCACATATACATTAGTAAACAGATCAGAAGGATCATAATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290537] SGN-U575372 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102216 [Download][View] Facility Assigned ID: TPSCZ48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5