EST details — SGN-C77343
| Search information |
| Request: 77343 | Match: SGN-C77343 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C77343 | Clone name: cLES-20-K18 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C179321 is on microarray TOM1: SGN-S1-1-2.4.2.8
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C179321 [TUS-31-H7] | Trace: SGN-T185390 | EST: SGN-E373252 | Direction: 3' | Facility: INRA |
| Clone: SGN-C179321 [TUS-31-H7] | Trace: SGN-T185391 | EST: SGN-E373253 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E290385 | Length: 173 bp (734 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E290385 [] (trimmed)
CGGGCTGCAGGCCTGAGGACAGTAAGCGTGCGAGATGAGTTAGAAAAGCTGAATGTCTGGGTGGCCTTCTTCAATTTTGAAAACGAGTATGGAAA
TCCCCCAGAGGAAGCTGTTGCCAAAGTATTCCAAATAGCATTGCAGTATAGTGATCCCAAAAAAGTGCATTTGGCCTT
TCCCCCAGAGGAAGCTGTTGCCAAAGTATTCCAAATAGCATTGCAGTATAGTGATCCCAAAAAAGTGCATTTGGCCTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E290385] | SGN-U570303 | Tomato 200607 | Build 2 | 5 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T102064 [Download][View] | Facility Assigned ID: TPSCZ69TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.969 | Expected Error Rate: 0.0373 | Quality Trim Threshold: 14.5 |
Working
