EST details — SGN-C77368

Search information 
Request: 77368Match: SGN-C77368
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77368Clone name: cLES-20-L21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179330 is on microarray TOM1: SGN-S1-1-1.4.2.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179330 [TUS-31-H16] Trace: SGN-T185654 EST: SGN-E373516 Direction: 3' Facility: INRA
Clone: SGN-C179330 [TUS-31-H16] Trace: SGN-T185655 EST: SGN-E373517 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290593Length: 278 bp (1166 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290593 [] (trimmed) TAGAATTTTATTGAAGTAAATGGAATCACAGTTTATTGAAAGATACCATAGTCATCAGCCTAGTGAACATCAGTGTTCTTCATCTCTTGTTAAAC
ACATCAAAGCACCAGTTGATATTGTAAAAATCATATCTTTTTTAGAATTATTCTCTTGATTTCTTGATTTGGGAGTAATTTTTATTTTGTGGGGT
TGGGGGTTCTTGAGGATTTCTCTTATTTATTTCTAGTTATACGACATTGGGTTTGTATAACATGATTGTATCTTTTTGTTCTATCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290593] SGN-U577680 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102272 [Download][View] Facility Assigned ID: TPSDA71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5