EST details — SGN-C77491

Search information 
Request: 77491Match: SGN-C77491
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77491Clone name: cLES-2-C24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185427 is on microarray TOM1: SGN-S1-1-8.2.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185427 [TUS-47-F17] Trace: SGN-T192608 EST: SGN-E391282 Direction: 3' Facility: INRA
Clone: SGN-C185427 [TUS-47-F17] Trace: SGN-T197666 EST: SGN-E396340 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281968Length: 448 bp (609 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281968 [] (trimmed) GCCGCAGTGCCACTGATTTCTCTCCTCCAGACGAAGATGCAGATCTTCGTGAAAACCCTAACGGGGAAGACGATCACCCTAGAGGTTGAGTCTTC
CGACACCATCGACAATGTGAAAGCCAAGATCCAGGACAAGGAAGGGATTCCCCCAGACCAGCAGCGTTTGATTTTCGCCGGAAAGCAGCTTGAGG
ATGGTCGTACTCTTGCCGACTACAACATCCAGAAGGAGTCCACTCTCCATCTCGTGCTCCGTCTCCGTGGTGGTGCTAAGAAGAGGAAGAAGAAG
ACCTACACCAAGCCAAAGAAGATCAAGCACAAGAAGAAGAAGGTTAAGCTCGCTGTGTTGCAGTTCTATAAGGTTGATGACACTGGAAAGGTTCA
GAGGCTTCGTAAGGAGTGCCCTAATGCTGAGTGCGGTGCTGGAACTTTTATGGCTAACCATTTTGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281968] SGN-U580697 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97128 [Download][View] Facility Assigned ID: TPSAF24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5