EST details — SGN-C78231

Search information 
Request: 78231Match: SGN-C78231
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78231Clone name: cLES-5-A13
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185458 is on microarray TOM1: SGN-S1-1-1.3.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185458 [TUS-47-G24] Trace: SGN-T191949 EST: SGN-E390623 Direction: 5' Facility: INRA
Clone: SGN-C185458 [TUS-47-G24] Trace: SGN-T192188 EST: SGN-E390862 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285564Length: 352 bp (719 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285564 [] (trimmed) CAGAAATTACAGAGAGTAATTTTCAAATAAACTTTTGTTATTTTGTGAGTCTTTAGAGTTAGTCAAGTACAAATGGCTACCTCCATCTCAACCAT
TGGAGCTGTCAACAAGTTGAGTTTGAACAACTCTGTTGTTGGAACTTCAGTTCCACCAACAGCCTTCTTTGGCAAAACCTTAAAGAAAGTGAACA
ACAAAGTTTCCAGCACAAACATCTCAAACAAGAACTTGAGGCTGGTTGCTCAAGAAAAAGAAATTGATGAGAAGAAACAGACTGATGGGGACAGA
TGGAAGGGACTTGTTAACGATGTGTCCGATGATCAACAAGACATTGCAAGGGGTAAAGGTTTGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285564] SGN-U580240 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98047 [Download][View] Facility Assigned ID: TPSAQ07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5