EST details — SGN-C78309

Search information 
Request: 78309Match: SGN-C78309
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78309Clone name: cLES-5-E16
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178947 is on microarray TOM1: SGN-S1-1-8.4.2.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178947 [TUS-30-H17] Trace: SGN-T1516 EST: SGN-E378550 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178947 [TUS-30-H17] Trace: SGN-T184685 EST: SGN-E372245 Direction: 3' Facility: INRA
Clone: SGN-C178947 [TUS-30-H17] Trace: SGN-T184686 EST: SGN-E372246 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285773Length: 480 bp (768 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285773 [] (trimmed) TTTTTTTAACACTTGAAATGTTTTTCCAACATTATTCAAATAAAAATTAAGCAATCTGTTTAAGTCTACAAACAGTTCCCACCCTGACCAAAAGA
AGTAACATTATGCATGTTACATGTAACCATTAAAACATATTATGAACCATAATGATGAACAGATCAAAGTAGGTGCTGAAGTCGTAAATGTATTG
CTTACTACATGCGTGACCTTGATGTCGAAGATGTAGCAGCAGGAGCGCTCAAGGGAATGCCCTTTGCTGCTCTCTCTTCCAAGAACTTTGATGGC
TTGAAGGAAATCTTCATCTAGTGTCAAACCTTCAAAAACTTTGTTTGTCATAAATTTTGATCCATATAGTACTAGGAGCAGGGATATAGAGAGGC
ACTTTGATCCATATGGAAAAATACTCAATATAAGGATTAGAAGAAATTTTGCATTTGTTCAATATGAAACTCANGAGGATGCTACTAGAGCCTTG
GATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285773] SGN-U565748 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98256 [Download][View] Facility Assigned ID: TPSAR32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5