EST details — SGN-C79526

Search information 
Request: 79526Match: SGN-C79526
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C79526Clone name: cLES-9-E3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185506 is on microarray TOM1: SGN-S1-1-1.1.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185506 [TUS-47-I24] Trace: SGN-T191958 EST: SGN-E390632 Direction: 3' Facility: INRA
Clone: SGN-C185506 [TUS-47-I24] Trace: SGN-T191959 EST: SGN-E390633 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287612Length: 255 bp (651 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287612 [] (trimmed) TTTTTGGGATCGTGAAGAACAACACCGTCCGGGATGTCGAAACGAGGACGAGGAGGTTCCGCCGGGAACAAGTTCAGAATGTCACTGGGTCTGCC
GGTGGCGGCGACGGTGAACTGCGCCGATAACACTGGTGCTAAGAACCTGTACATCATTTCCGTGAAAGGGATCAAGGGAAGGCTTAACAGGTTGC
CTTCAGCTTGTGTTGGAGATATGGTGATGGCTACTGTGAAGAAGGGTAAGCCAGATCTCANGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287612] SGN-U580698 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99431 [Download][View] Facility Assigned ID: TPSBG26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0239 Quality Trim Threshold: 14.5