Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C80072

Search information 
Request: 80072Match: SGN-C80072
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80072Clone name: cLET-11-C6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183571 is on microarray TOM1: SGN-S1-1-8.1.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183571 [TUS-42-I9] Trace: SGN-T194941 EST: SGN-E399165 Direction: 3' Facility: INRA
Clone: SGN-C183571 [TUS-42-I9] Trace: SGN-T195491 EST: SGN-E394165 Direction: 3' Facility: INRA
Clone: SGN-C183571 [TUS-42-I9] Trace: SGN-T200246 EST: SGN-E399166 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292653Length: 320 bp (744 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292653 [] (trimmed) GTGGAATTGACGCTGTTGTTTTGTACAGCCCGAAGATTTTTGAAAAAGCCGGGATCAAGTCCGATCACGACAAGTTGCTCTGCACCGTCGCCGTC
GGAGTAGTCAAAACATTGTTCATTCTAGTAGCCACATTTATGCTTGACAGATCCGGTCGTCGGCGGTTGCTATTAACCAGTGTCGGCGGAATGGT
GGCGTCGTTGGTGCTTCTCGCGACAGGCCTCACAATTATCGAACACTCAGAACAGAAATTAATTTGGGCAATAGCACTCTGCATAGCAATGGTGT
TAGCTTACGTGGCGCTTTTCTCAATCGGTATGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292653] SGN-U565600 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105116 [Download][View] Facility Assigned ID: TMEBP15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5