EST details — SGN-C80099

Search information 
Request: 80099Match: SGN-C80099
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80099Clone name: cLET-11-E10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179636 is on microarray TOM1: SGN-S1-1-7.1.1.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179636 [TUS-32-E10] Trace: SGN-T1542 EST: SGN-E378556 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179636 [TUS-32-E10] Trace: SGN-T185974 EST: SGN-E372479 Direction: 3' Facility: INRA
Clone: SGN-C179636 [TUS-32-E10] Trace: SGN-T185975 EST: SGN-E372480 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292838Length: 339 bp (770 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292838 [] (trimmed) CCATGGCCGTCGCCGTATCCACCGCCGTCACCAACAAGTCTCATCTTTCATCGGCACTCGACAAACCCTTTACCACGCCATCCCAAAAGCTCTTA
TCTTTAGCCGTTAAAACCCTCCCAAAACCCTACCACCACCATCACAGAACTCTCATTACTGCGGCCTCCAAGAACCCATTAACCGACGTCGTTTC
GTCCAAACCCATCCCGGATGGACGTTCTTTTGATTCTTATTTCCACGACGATGACGATAAACCCCGTGAAGAGTGCGGCGTGGTCGGTATTTACG
GTGATTCTGAAGCTTCTCGTCTTTGCTATTTAGCCCTTCACGCGCTTCAACACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292838] SGN-U569321 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105301 [Download][View] Facility Assigned ID: TMEBP29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5