Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C80141

Search information 
Request: 80141Match: SGN-C80141
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80141Clone name: cLET-11-F8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179656 is on microarray TOM1: SGN-S1-1-3.2.1.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179656 [TUS-32-F6] Trace: SGN-T186301 EST: SGN-E372820 Direction: 3' Facility: INRA
Clone: SGN-C179656 [TUS-32-F6] Trace: SGN-T186302 EST: SGN-E372821 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292922Length: 495 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292922 [] (trimmed) TGGTGGTCGCTATTATACGCCAGTAGGTACAGTACGCACCATCAACTTCCATTTTTGTACACACAGAGCTTCTATATATATCTTCTCTCATTCAC
ATTTCCTACGTGAATGCCTAATAATTCACCATTCGCTTCGGATTTGGATCGGGTATTGAAATGGATCCACAAGCTTCCATGATGAACCACGCCGG
AGGATTTCAGTCTCCGCCGTTTAATTTATCTGAGATCTGGCAGTTTCCGATCAATGCAGGTGAAGGTGAGACGCCGTATAGTTTTCCGTTGTCTA
CGGCGGCTGCGCCGCAGAATGTGAGTGATGATGTTCGGAATAATGATCCTATGGTTCTAGACCGGAGAACTAATAATTACAGCGGTGGCGGCGGT
GGTGGTGCANCTAGGAAGCGAAACGAGGATGATGAATCAGCTAAAGGAGTTTCCACTAGCGGCAATGGCTTGACTGAATCTGCTAGTAAGCGGAT
GAAGGTTACAAGATCAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292922] SGN-U583136 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105385 [Download][View] Facility Assigned ID: TMEBR28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5