EST details — SGN-C81342

Search information 
Request: 81342Match: SGN-C81342
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C81342Clone name: cLET-15-N18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184825 is on microarray TOM1: SGN-S1-1-2.1.14.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184825 [TUS-45-M15] Trace: SGN-T198512 EST: SGN-E397186 Direction: 5' Facility: INRA
Clone: SGN-C184825 [TUS-45-M15] Trace: SGN-T198589 EST: SGN-E397263 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293526Length: 526 bp (937 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293526 [] (trimmed) AATATGTCAGTGACACTTCATACAAATCTAGGTGATATCAAGTGCGAAATCTTCTGTGATGAAGTGCCAAGAACAGCAGAGAATTTCTTGGCGTT
ATGCTCAAGTGATTATTATGATGGGACCATATTCCATAGAAACATAAAGGGTTTCATGATCCAAGGTGGTGATCCAACTGGTACTGGGAAAGGTG
GGACAAGTATTTGGGGAAAAAAGTTCAATGACGAGATAAGGGAGTCTCTCAAGCACAATGCAAGAGGGATGTTGGCAATGGCCAACAGTGGCCCT
AATACCAATGGGAGTCAGTTTTTCATTACATATGCCAAGCAACCACATCTCAATGGATTGTACACCATCTTCGGGAAAGTGATACATGGATTTGA
GGTTCTTGATCTCATGGAAAAGACTCCAACAGGACCAGGTGATAAACCCCTTGCCGAGATCAGGCTCAACCGGGTGACCATTCATGCTAATCCAC
TTGCTGGCTGACATACTTTTGAAGCATGCCAAAGCAGTATGTGTAATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293526] SGN-U566538 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106477 [Download][View] Facility Assigned ID: TMECH81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5