EST details — SGN-C81456

Search information 
Request: 81456Match: SGN-C81456
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C81456Clone name: cLET-16-J12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182205 is on microarray TOM1: SGN-S1-1-6.4.10.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182205 [TUS-38-P11] Trace: SGN-T194498 EST: SGN-E393172 Direction: 5' Facility: INRA
Clone: SGN-C182205 [TUS-38-P11] Trace: SGN-T194737 EST: SGN-E393411 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292595Length: 290 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292595 [] (trimmed) CGACGGGACATACTCTACGACTCTTATCCTTGCCAGACTTCTTGGATAAATCAATTGGAAAGCTATTGAAGTTGAGACAGAAGATAGCTTCTGCC
ACTTCAGCAATAAAGTCTGTCTTTGGCCAGGAAGGAACGCCCAAGCCAGATGCTGCAGATAAATTGGAGCGGTTAAGGGAGAGGATGATAAAAGT
AAGAGAGCTTTTTCGTGACACAACCTCGACAGAATTTATCATAGTAACAATCCCCACGGTTATGGCAATTACCGAATCGCCCAGGTTGTGGGCTT
CCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292595] SGN-U573791 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106728 [Download][View] Facility Assigned ID: TMECL54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0304 Quality Trim Threshold: 14.5