EST details — SGN-C82132

Search information 
Request: 82132Match: SGN-C82132
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82132Clone name: cLET-1-A15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179369 is on microarray TOM1: SGN-S1-1-2.2.2.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82132 [cLET-1-A15] Trace: SGN-T102544 EST: SGN-E292270 Direction: 3' Facility: TIGR
Clone: SGN-C179369 [TUS-31-J7] Trace: SGN-T185488 EST: SGN-E373350 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292056Length: 226 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292056 [] (trimmed) GGTATGAGAGTGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCACCTAACTCTTCCACCATTGCTAGCAATGGAAGCGATGTCA
AGGTTTTGCTTCTTTGTAACATGGAAAGGGGCTGAAGATTCGAGACCAGTGAAAGGCGCACCCATGCTAGCTTGTGTAACATTGCTGCTGTGTGG
CAACAGCTGCTCAAGATAGAGAGAGAGAGAGAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292056] SGN-U578689 Tomato 200607 Build 2 989 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102330 [Download][View] Facility Assigned ID: TMEAA08THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0