EST details — SGN-C82159

Search information 
Request: 82159Match: SGN-C82159
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82159Clone name: cLET-1-B22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179387 is on microarray TOM1: SGN-S1-1-8.3.2.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179387 [TUS-31-K1] Trace: SGN-T185137 EST: SGN-E372680 Direction: 3' Facility: INRA
Clone: SGN-C179387 [TUS-31-K1] Trace: SGN-T185138 EST: SGN-E372681 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292222Length: 463 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292222 [] (trimmed) CAAAATGGCAGCCTCTCTACAAGCAGCTGCTACTCTTATGCAACCAACTAAAGTTGGTGGTGTCTCTGCCAGAAACAACTTGCCATTGAGGTCAG
CTCAAAGTTTGAGCAAGGCATTTGGTCTTGAACCATCTGCATCCAAGCTTTCTTGCTCTTTGCAAGCTGATCTTAAAGATTTTGCTCACAAATGC
ACTGATGCTGCCAAGATTGCAGGATTTGCCCTTGCCACTTCTGCCCTTGTTGTCTCAGGAGCTAATGCTGAAGGAGTTCCAAAACGTCTAACCTT
TGATGAGATCCAGAGCAAGACATACATGGAAGTAAAGGGAACTGGAACAGCAAACCAGTGCCCTACCATAGATGGAGGTGTTGATAGCTTTTCCT
TCAAGCCAGGCAAATACAACGCCAAGAAGTTCTGCTTATAGCCAACATCATTCACCGTCAAAGCAGATGGCGTAAGCAAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292222] SGN-U580345 Tomato 200607 Build 2 207 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102496 [Download][View] Facility Assigned ID: TMEAD11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5