EST details — SGN-C82323

Search information 
Request: 82323Match: SGN-C82323
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82323Clone name: cLET-1-J20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C185275 is on microarray TOM1: SGN-S1-1-8.4.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T1887 EST: SGN-E378648 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T199066 EST: SGN-E397740 Direction: 5' Facility: INRA
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T199119 EST: SGN-E397793 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292245Length: 532 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292245 [] (trimmed) CAAATGTTGTAGAAACAGTAGAATTACAAAAGCACTAAAAGATACTTGAACGGTTTTTTTTTTTACTTTAAAGAACATAGCCAATAAAGGAAAGA
GATGGCCTTATTTTCTAGCAGTTTCAGCAAAATGGAAAGGGGAAGGTTTAGACAAGAACATTCTGCTTCATCAGAAGCCCTATTCGCGACGATGA
TGTAGTAATCGAAGGACAAAAAGTTCAAGGCTCCACAGTCATGTTCTCTGCTTCTCGTCTGACAGTTTCGAAGAGCACAGAGGAAAGATATCGCT
CCCCGAAGCTTGGGAAAACAACAACAATGAGCTTCCCAGCATTTTCAGGACGCTTAGCAACTTTAATTGCCGCAGCAGCAGCAGCACCAGATGAT
ATTCCCACTAGCAATCCTTCCTTCAATGCCAGAAGCTTAGCCATTTCTATGGATTCATCACTTGAAACCTGAACTACATCGTCAATAAGGTTAAC
TTCCAAAACACCAGGAACGAAACCAGCACCAATCCCCTGAATCTTATGTGGACCAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292245] SGN-U585413 Tomato 200607 Build 2 74 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102519 [Download][View] Facility Assigned ID: TMEAD58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0030 Quality Trim Threshold: 12.5