EST details — SGN-C82754

Search information 
Request: 82754Match: SGN-C82754
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82754Clone name: cLET-21-F22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183248 is on microarray TOM1: SGN-S1-1-3.3.3.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183248 [TUS-41-K22] Trace: SGN-T196517 EST: SGN-E395191 Direction: 5' Facility: INRA
Clone: SGN-C183248 [TUS-41-K22] Trace: SGN-T200118 EST: SGN-E398792 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293702Length: 531 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293702 [] (trimmed) GGCATTGCACCTGAATCAAAGGCAACGACAGAGAGTGTATATAATGCAGCTTTGGCTTTAGGGATCGCAAATCAACTAACCAATATACTCAGAGA
TGTAGGAGAAGATGCAAGAAGAGGAAGAGTATACTTACCTCAAGATGAATTAGCACAGGCAGGGCTCTCCGATGAAGACATATTTGCTGGAAAGG
TGACTGATAAGTGGAGAATCTTTATGAAGAAGCAAATCCAGAGGGCAAGGAAATTCTTTGATGAGGCAGAGAAAGGTGTCACAGAACTGAGTTCT
GCTAGTAGATGGCCGGTGTTGGCATCGTTGCTGTTATATCGCAAGATACTGGACGAGATTGAAGCAAACGACTACAACAACTTCACAAGGAGGGC
TTATGTGAGCAAGCCAAAGAAGCTTCTGACGTTGCCCATTGCTTATGCAAGATCTCTAGTGCCCCCTAAGTCAACTTCTTCCCCACTAGCAAAGA
CATGAATGAAGTTTCTAAATGCCAATTAGAGGCCTATACATACACTAAAGAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293702] SGN-U578302 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107824 [Download][View] Facility Assigned ID: TMEDF35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0116 Quality Trim Threshold: 12.5