EST details — SGN-C9416

Search information 
Request: 9416Match: SGN-C9416
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C9416Clone name: cLEC-5-N24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183624 is on microarray TOM1: SGN-S1-1-3.3.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T195049 EST: SGN-E393723 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T196042 EST: SGN-E394716 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T196042 EST: SGN-E399294 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T199658 EST: SGN-E398332 Direction: 3' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T200315 EST: SGN-E399293 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201054Length: 271 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201054 [] (trimmed) ATTAAACAACAAATTGATTCGAAGGATTTTATCAAATGGCCAAGATTTCTCGTCTTTTTGGATCCACCGTGAAAGCAGCTATCACCGCCCAGGCT
GGTTTCCATGGAAAACGTATTCCAGCAGTTAGCAGTTTACAGGAGCATATTGTTAAATCAACACCGGCAAGATATAACAGTCACAGGCATGTTTG
GAAATGATATTTTGGACTGATATAAAGGGTTAAGGTCATGATATGTTGGCCCCTTCACTGTGGGTGGAAAGACTGATGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201054] SGN-U570910 Tomato 200607 Build 2 76 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23889 [Download][View] Facility Assigned ID: TCAAT84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5