EST details — SGN-C9437

Search information 
Request: 9437Match: SGN-C9437
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C9437Clone name: cLEC-5-P14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183863 is on microarray TOM1: SGN-S1-1-4.1.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183863 [TUS-43-E13] Trace: SGN-T196222 EST: SGN-E394896 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200945Length: 300 bp (1034 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200945 [] (trimmed) ATACAAGCTTCTTGTCTCCAAAATTCATATCTTTTAAGTGATAGAAATCATAAAGTTCTGAGAAAGTTCAAATCTTGGGAGTGTTGGTTTAATTT
CTTGAGTGAGGAGTTATGACTTTTGGGTCTGAATGGAAGTTCTCTCAAGTCTTTGGTGAACAAAATCCCCATGAGGATGTACAAGATTGTGATAT
TATCTCTGCAATGGAGTTTGACAAGAATGGTGATAATCTGGCTGTTGGAGATCAAGCTGGACGTGTCATGATTTTTGAGCGGCATGCTGGTAAAG
AAGATCTCTTTGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200945] SGN-U575335 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23780 [Download][View] Facility Assigned ID: TCAAT91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5