Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E200331

Search information 
Request: 200331Match: SGN-E200331
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3207Clone name: cLEC-1-G17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3207 [cLEC-1-G17] Trace: SGN-T24545 EST: SGN-E200332 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200331Length: 397 bp (834 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200331 [] (trimmed) CAAACTGTAAATTGTTCCTTTGGACTTCTCATACTTTCATCCTTCCTGTTTTCGTCTGAGATCGTCAAATGCAGTCCTTCAAAGCCGCTCCCAGT
AACCCACAGGGTACAGGAACAAACACGGAACAGGTGTATTCTGAATTGGAGAATTTTGTTGTGACAGAAAATAGTTTGAATAATGACCAGTCTGT
GGATGTCGAGGACAGTGGTTCGGGGGATAATAGTGAGTTGGATCCAGAGGCATCACGATTAATTCCTGGGCTTCCTGATGACATTGCACTTTTCT
GCTTGGCAAGGGTTCCTCGAAGGCATCACGTGCTTCTGAAATGTGTGTCAAGAAAATGGAGAGACTTGGTTAGTGGTGAAGAGTGGCACTCCTAT
AGAAAAAAACATGATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200331] SGN-U586470 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24544 [Download][View] Facility Assigned ID: TCAAA45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0186 Quality Trim Threshold: 14.5