Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E202647

Search information 
Request: 202647Match: SGN-E202647
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3066Clone name: cLEC-19-D3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C186542 [TUS-50-E4] Trace: SGN-T351593 EST: SGN-E550718 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202647Length: 452 bp (841 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202647 [] (trimmed) GTTTGTCACTCTGCTTGGCATCATCATCATCACATGCCAATATTCTTGGCCAACCACACTACTTTTGATTCCTCTAGGCTGGCTAAATGTTTGGT
ACCGGGGATATTATCTTGCAACATCTCGTGAATTGACTCGGCTTGACTCAATTACAAAAGCACCCGTTATTCATCATTTCTCTGAAAGCATCTCA
TGTGTTATGACTATACGCTGCTTTAGGAAGCAGGAGATGTTTAGTCAAGAAAACGTTAACCGAGTTGATGCCAATCTGCGAATGGATTTCCACAA
CAATGGATCCAATGAGTGGTTGGGATTTCGACTGGAACTGCTTGGAAGCTTGCTTCTCTGTGTTTCTGCAATGTTCATGATTATCTTACCTAGCA
GCATCATCAAGCCAGAGAATGTTGGCTTATCGATATCATATGGTTTGTCCCTTAACAGTGTGCTATTCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202647] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27488 [Download][View] Facility Assigned ID: TCACW14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5