EST details — SGN-E203078

Search information 
Request: 203078Match: SGN-E203078
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C400Clone name: cLEB-3-F11
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C400 [cLEB-3-F11] Trace: SGN-T22825 EST: SGN-E203079 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203078Length: 463 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203078 [] (trimmed) TCCAGACTATGGTCGTGGCCGAGATCGGCCTAGTCCAGACTATGGTCGTGGTCGAGATCGGCCAAGTCCAGACTATGGTCGTGGTCGAGATAGGC
CTATTTCTGACTTCGATCGCGGTAGAGATCGGCCAAATTCTGACTTTGGTCGTGGTAGAGATCAGCTAAGTCCTGACTATGGTCGTGGCCCTAGT
CGAAGTCCTAAGCACAGGGAAGGGAATTCTGAGTATGGCCGTGGCCATAGTCCAGCTGTAGGAAAGGAGAGAAATCCTGGTCATGGGAATGTTCG
TAGCCCTAGCCCTCGTAGGGAAAGAACAGGTCCAGGAAATGGTCTTATGAGCAGTCCACTGAACATAAGTCCTGGTTATGGTGATGGACCCAGTC
CTAGTGCTCAGAGGGAGAGGAGAGATTAATATAGCCCGGATGGTCATAATCGTGGCAGCAGCCCATGTCCTAAACCTGAACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203078] SGN-U565745 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22824 [Download][View] Facility Assigned ID: TSHAK30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5