EST details — SGN-E203703

Search information 
Request: 203703Match: SGN-E203703
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2319Clone name: cLEC-15-J14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181050 is on microarray TOM1: SGN-S1-1-1.4.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181050 [TUS-35-P8] Trace: SGN-T193964 EST: SGN-E392638 Direction: 3' Facility: INRA
Clone: SGN-C181050 [TUS-35-P8] Trace: SGN-T199206 EST: SGN-E397880 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203703Length: 471 bp (809 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203703 [] (trimmed) GTCGTGCTGGATGAGGCACAAAGGATCAAGAATTACAGAACCCAAGTAGCTAGGGCTTGTTGGGGTCTCCGAGCTAAACGTAGATGGTGTTTGTC
AGGAACACCTATCCAAAATGCAGTTGATGACCTTTACAGTTACTTCAGATTCCTCAAATATGACCCATATGCAGTGTACAAACAATTCTGCTCCA
CAATCAAGGTTCCAATCCAAAGACACCCAACAACTGGGTACAGAAAGCTGCAGGCCGTGCTTAAGACTGTTATGCTTCGTCGCACTAAAGGTACT
TGTATTGATGGAAAACCCATTATCAACCTTCCAGAGAAACACATTGTTCTGAGAAAAGTTGAATTTACGGATGAGGAACGAGAATTCTACTGCAG
ACTTGAAGCTCAATCACGTGCTCAGTTTGCTGAATATGCTGCTGCTGGGACTGTCAAACAAAATTATGTGAACATACTCTTGATGCTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203703] SGN-U604016 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26804 [Download][View] Facility Assigned ID: TCACH55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5