EST details — SGN-E204445

Search information 
Request: 204445Match: SGN-E204445
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1799Clone name: cLEC-13-P10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173184 is on microarray TOM1: SGN-S1-1-3.4.20.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173184 [TUS-15-H14] Trace: SGN-T189006 EST: SGN-E375392 Direction: 3' Facility: INRA
Clone: SGN-C173184 [TUS-15-H14] Trace: SGN-T189007 EST: SGN-E375393 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204445Length: 364 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204445 [] (trimmed) TATAACCTCCCACTCCACTTAGCCGGAGCAGCCGTACACCTACGCCTAGCTACAAATCGTATACATGGATGGAACCCAGTCTTCACCTCCACCGT
CAAATTCCACGAACTCCCAATCCCAAATGACGAAACCCCTCTTCCTAATCCAAATTCCACCACCAAATTCCCTTCCCAATTGATGCCGTCTTTCC
ACGCCACGATTCATCTTCGTCACCCGATTACTTTCCTTTTACAAGAACTCTCCAGAAATTACAGAAGAGTCATTGGTATTTACGATTCTTTAATA
GCTTGGGTTCTTCAAGATACACCTTCTATACCAAACGTTGAGTGTTACAGCTTTCGTAGCATCTCAGTTTTTTCGATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204445] SGN-U586639 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26198 [Download][View] Facility Assigned ID: TCABZ89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.863 Expected Error Rate: 0.0047 Quality Trim Threshold: 20.5