EST details — SGN-E204810

Search information 
Request: 204810Match: SGN-E204810
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1911Clone name: cLEC-14-E16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173240 is on microarray TOM1: SGN-S1-1-3.2.19.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204810Length: 367 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204810 [] (trimmed) CCCCAGCTTAAGTTTTCTTTCAATTGCTATAAAAAAAAACAAGGGGCTTTCTATTACTTATAATTCCGGCTCCAAATTCACCAAAATGCCCCTAA
AAATGTTTTGAATTTCATATCAAAGCCTTTTTTTTTTACATTTTCCCAACAAAAGGGCATCTTTTCTCTATGCCATATAGGCCGCTCTTTTAGCC
ATCAATCTTCTACTTTTAGTCGACTGCTCTAGAACCGAACTTTCTTTTTTTTTAGGGCTCCCTTCCCCCTCACCAGGTAATAATTTAAAGAACGA
CTTTTTTGGCTTTTTTTTTTAGGCGACTGCTTTACCAATCACACATTGCCTTACACTTGGCATCGGGGGTTATCGCCTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204810] SGN-U589517 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26426 [Download][View] Facility Assigned ID: TCACB32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0349 Quality Trim Threshold: 14.5