Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E207846

Search information 
Request: 207846Match: SGN-E207846
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5701Clone name: cLEC-32-L22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173852 is on microarray TOM1: SGN-S1-1-7.4.17.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207846Length: 460 bp (798 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207846 [] (trimmed) GAGAGATTACTTTTATTTTGGAAAACAATGTTTGCAGAACAGAGAATGTGTTTTCCTATCCTTCTCTTCATTTATGTCCTCTTATCTTCGTCTCG
ATTTGTTATATCACAATCTTTCCTGGACTACAACATCAGTCTTCCGAATTCTACTGCAGGGCATGCCGGACTTTCCTCTGTATCGATCAACAGGC
CATCTCTTATTGTTAATTCCACCACCGATGGCTTCTCAACGCCCATACTTTATCGGGGAAATGCTGGCCCACGATTCCTCTATGGCTTCTACTGC
AGGTACAATGACACAGAATGCCTTCTTGGTATCTTTTTGTACCACAACAAATACAACGAGCAGAACGGTATGATAGATAAACCCCAGTTAGTTTG
GTCTGCTAACAGGAACCGTCCAGTGAAATTCAATGCAACCTTGGAACTAGGCCAAGATGGCAACTTGGTTTTGACAGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207846] SGN-U581677 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30059 [Download][View] Facility Assigned ID: TCAEX71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5