EST details — SGN-E208685

Search information 
Request: 208685Match: SGN-E208685
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7655Clone name: cLEC-39-L3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183373 is on microarray TOM1: SGN-S1-1-6.1.2.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183373 [TUS-42-A3] Trace: SGN-T196113 EST: SGN-E399116 Direction: 3' Facility: INRA
Clone: SGN-C183373 [TUS-42-A3] Trace: SGN-T200229 EST: SGN-E399117 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208685Length: 425 bp (814 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208685 [] (trimmed) CTCTCTGAGAGAGAGTCTAAATTGGTCATCTCCACAATCAATGGCTGCCGCCGCCAGAATCTCCGCCTCCTCTACCTCACGAACTTTTTATTTCC
GTCATTCACCGTTTCTTGGCCCAAAACCTACTTCGACAACCTCACATGTTTCTCCAATCTCTCCTTTTTCTCTTAATCTAGGCCCAATTTTGAGG
TCTAGAAGAAAACCCAGTTTCACTGTTTGCTTTGTTCTCGAGGATGAGAAGCTGAAACCTCAATTTGACGATGAGGCTGAGGATTTTGAAAAGAA
GATTGAGGAACAGATCTTAGCTACTCGCTTGGCGGAGAAACTGGCTAGGAAGAAATCGGAGAGGTTCACTTATCTTGCGGCTGCTATAATGTCTA
GTTGGGGGATCACTTCTATGGCTGTTGTGGCTGTTTATCACAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208685] SGN-U568606 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31975 [Download][View] Facility Assigned ID: TCAFY62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0225 Quality Trim Threshold: 14.5