EST details — SGN-E210363

Search information 
Request: 210363Match: SGN-E210363
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6609Clone name: cLEC-35-P13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174034 is on microarray TOM1: SGN-S1-1-1.3.17.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174034 [TUS-17-K24] Trace: SGN-T197026 EST: SGN-E395700 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210363Length: 308 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210363 [] (trimmed) TTGAGGTGGAAATCCCAGCTAAGCGAACATCTGATGGAACAAGGTTTAAACCTAGGCCAAAAGTTCTCTGCAAATCTAGTCACTCATATATGAGC
ATGGAGGGTACAGAGATTAGTTTGTCCCACAGGGACTGATATCCTCATATGAGACTAGACCCCTCGGTCGAGGAGGGGAGGTTGATCTCGAACTA
TCAGGCGATGCGGATCCTACTTTCCTACTGTGCTTCCTTGGAGCAACAGAAGGGGATCGAGGAGTAGTACAGGCGCGGCTTCTAGATCATGAGGC
TGACCTCCTAGTTGGAATAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210363] SGN-U571223 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30711 [Download][View] Facility Assigned ID: TCAFI91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0305 Quality Trim Threshold: 14.5