Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E212709

Search information 
Request: 212709Match: SGN-E212709
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11974Clone name: cLEC-73-D11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E212709Length: 452 bp (910 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E212709 [] (trimmed) GCCTACAAAGGGTTTAGTTCCGAATGTTGTGACTTACACAGCATTGATTTCTGGCTTATCAAAAGAAGGCAGATCAGGTGAAGCCATCCGATTAT
ACAATCAGATGATAGAGGCAGGCGTAGTACCCGATGCTGCTGCATACTCTGCACTTAGTTTTTTGGCGGACAACTGGAGTAGCAAAGGTCCTCTA
GCCAATGATTACCATGAAACATAGAAGAATACGGAGACTCTAGTAAGACATTTCATTACCAATGGAACTTGGGACAATGCAAAGATGCAGAACAT
CCTATGAGATAGCACAATTCAGCATATTAAGACCATTTGGAATTGGCAAGTATGACACTCAAGACCAGGTCTTTTGGGACCTCACAAAAGATGGG
AAATATTCCAACAGACCACAATATTGATCAGCTCAATATGTGTGGAAGCAATTTGGAAGGCCTCTGGCAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E212709] SGN-U598121 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T35439 [Download][View] Facility Assigned ID: TCALE18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0128 Quality Trim Threshold: 14.5