EST details — SGN-E214332

Search information 
Request: 214332Match: SGN-E214332
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C13135Clone name: cLEC-77-A15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E214332Length: 201 bp (871 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E214332 [] (trimmed) GAGATTAACAAAGATAGAAATTTCNCATTTTGAGAAAAAAAAAGGAGATGGCTATTGCTGGTCATTGGGCATTTGTTTTTGGTGTCCTTGGAAAT
ATTATCTCGTTTATTGTTTTCCTTTCTCCAATACCAACATTTAATAAAATTTACAAGAAGAAATCAACTGAAGGATATCAATCAATTCCATACGT
GATTGCNTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E214332] SGN-U593019 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T36754 [Download][View] Facility Assigned ID: TCALS08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5