EST details — SGN-E215845

Search information 
Request: 215845Match: SGN-E215845
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51994Clone name: cLEL-15-K23
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E215845Length: 458 bp (743 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E215845 [] (trimmed) GCAATCAATTTCTGCATGTTACTACTATATCATATCAACCACATCTTCATAAATTACAATTGTACAGGTAAATAACATCAGGTCTCATACAAGTT
ACTACCATGTGGGATTATAATTTCCATCATTCTATATCATTTTCCTATGGATTCAACAATGTACAGTGCAGACTGAAAAAATTATCATTATATTA
AGTGGCACAGTGGACCTTCTCTATATACCCAGAGTAACAAGATTTTTTCACAATCTACAATGTTGTGTTGGAAATTAGCCGTACTTCATACAGAT
CATTCTCTCCCTTTACAATTTCAGATGATATTCCAGGTCCAAAGAAAGACGTAAATTTTGCCTGTCTTTTTTCGAAATCTGATAACTGCAGAGCT
TTTGCCTCAAATACCAGCACTAGACAGTATTTACCATTCTCAGTCACTTCTTCTCGAATATTTTGTAAGATTGGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E215845] SGN-U598409 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T6238 [Download][View] Facility Assigned ID: cC-esflcLEL15K23d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0194 Quality Trim Threshold: 14.5