EST details — SGN-E216246

Search information 
Request: 216246Match: SGN-E216246
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51258Clone name: cLEL-13-J2
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216246Length: 406 bp (810 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216246 [] (trimmed) GTCAGCAAAGTTTCTTGTGGTTCCATATCTGAATCTGGATTTTGTGCTACTATACAAGTGGGCAAAATAACAAATGTCAACTTCGTGACTAGCAT
GATCAGACGAGAACTTAATGAGATCTTCACAGCAACAGTCTAATCAATTGTTAAGACCATACCATGGAATACACACTTGTAGACCTTTGTAAGGG
ATGGTGTACCAACATAACCATATTTTAAGTAAAAACGAAGAAACATAATGTACTTAAGATCAGGAGGAATCAGTGGTTTGCGTCAGAGACAGGCA
AACCAGCTTTATGCAGATCTGCTATAGTCCCGGCAGCTTCTGCGAGATCATTCTTCATCATGCCAACTTTTGATGTAATATACTCTTTATATTTT
GAAACTGAATCAACAACAGCATAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216246] SGN-U603529 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T5007 [Download][View] Facility Assigned ID: cC-esflcLEL13J02d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5