Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E218106

Search information 
Request: 218106Match: SGN-E218106
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55101Clone name: cLEL-23-N11
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55101 [cLEL-23-N11] Trace: SGN-T10822 EST: SGN-E218030 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218106Length: 226 bp (913 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218106 [] (trimmed) GGGGGGTTTCGAATACTTTTAATGGTTCAAGGAAAAACATTTTTTTTTTGCTGGGGAGGTTTTTAAAAAGGGATGCCAGGTAAAAAAGGTTTAAA
ATTGGCTTAATTACCCCACAATTTCACGGGACAGGTAAAGGGAATATGGGGGTGGGGCAATGTTTTAAACATTAACATTGGTAGCCCCTGCGACA
TGTAAGTGCCCCACCTTTTGAAGTAAAAGGGCCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218106] SGN-U584720 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T10898 [Download][View] Facility Assigned ID: cC-esflcLEL23N11d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.843 Expected Error Rate: 0.0270 Quality Trim Threshold: 14.5