Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E220807

Search information 
Request: 220807Match: SGN-E220807
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54785Clone name: cLEL-22-M19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U581535 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E220807Length: 133 bp (697 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E220807 [] (trimmed) AGTGGCAAAATGTTTCAAGACAAAACATACAAAGAGAGGATGATCTATGGTACTACTACAATATATTGTGCATATTGTTACACAGCAGCCATATA
TACACCATACACAATAAAGTAAATATGAAAGTTGTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E220807] SGN-U581535 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T9951 [Download][View] Facility Assigned ID: cC-esflcLEL22M19d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0317 Quality Trim Threshold: 12.5