Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E221767

Search information 
Request: 221767Match: SGN-E221767
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C50036Clone name: cLEL-10-G12
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C50036 [cLEL-10-G12] Trace: SGN-T2982 EST: SGN-E221689 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E221767Length: 251 bp (489 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E221767 [] (trimmed) TCTCCATTCACTTTCATTCATGAGAACTTTGTAAACAAGGATCCACAGGGTAACATCACGGTAACAATAGCGGTCAAAAACGAGAACACTAACAG
TAACCACTGAAAAACCATAAACGTAACTTCAATCAAACTTCGAAACCATAAGTAAGTTCAGACGAGACCAATCTAAAAAGCCAACAGAAAATCTA
AATCCTACATGTGCCATCGGAACCACCACCGCCTACACCTGTTGAATAGCGATCGTTGTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E221767] SGN-U590380 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T3060 [Download][View] Facility Assigned ID: cC-esflcLEL10G12d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0234 Quality Trim Threshold: 14.5