EST details — SGN-E222047

Search information 
Request: 222047Match: SGN-E222047
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C50216Clone name: cLEL-10-O10
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E222047Length: 354 bp (767 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E222047 [] (trimmed) AAAAAAAGTTTCATTGTTTGTCTCTAAATTGCCTTAAACCGAAGCACACAGGAAAATCCAGAAGTGTTTTCATATTACATGCTCAGTGTCATTAG
ATAACAACCTGTTGTATCGAAAGATGTTACCAAAACTTCAAAACTGTCATAATCTCATTCTTCCTGTTGCTTCCATGGCTGATATGGCATCCCAA
GAACAAGAATTGTGTCCATTAGCTTGACCTGATGATGTGGTTACTGCATGGATTTGCTTGCAATCCCAGTCGCAATCATCGAAAAAGCAAGAACC
AAAAGGATCTTTCGAAGCCAGATGGTTATTAGCATGCTGTGTCTTGGGACTGGAAAAGATCGTCTGGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E222047] SGN-U573827 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T3340 [Download][View] Facility Assigned ID: cC-esflcLEL10O10a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5