SGN ID: SGN-C51490 | Clone name: cLEL-14-D12 |  | Order Clone |
|
Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E222978 | Length: 246 bp (951 bp untrimmed) |
Status: Current Version | Direction: 3' |
>SGN-E222978 [] (trimmed)
AAACTTCTAACAAGATAATAATATAATACCATGACAAGGTGATAGGCCCAAAAGTAACAAAATACAGTATTTTTAAAAATAAATTTGGACTCTCT
AGCCCAATATCTTAAACTTCTCGGTCTGTACATCGATTTCTTTGACTTCTTGACACGTGTGCATTTTCTGATTGAGTGAGTCAAAACGCATTTTG
TGAACCTATGACTCTTCTCGAAATGCAAGACGGGAGAGATTGCTTGGCGAACTCAG
[BLAST] [AA Translate]
SGN-ID: SGN-T5231 [Download][View] |
Facility Assigned ID: cC-esflcLEL14D12a1
|
Submitter: Koni |
Sequencing Facility: Cereon |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 |
Expected Error Rate: 0.0291 |
Quality Trim Threshold: 12.5 |